*** Welcome to piglix ***

Haplogroup G-FGC7535

Haplogroup G-FGC7535 (G2a1)
Possible time of origin about 3,000 years BP
Possible place of origin possibly South Caucasus region
Ancestor Haplogroup G2a
Descendants G2a1a
Defining mutations FGC7535/SK1106/Z6552

Haplogroup G-FGC7535, also known as Haplogroup G2a1 (and formerly G-L293), is a Y-chromosome haplogroup. It is an immediate descendant of G2a (G-P15), which is a primary branch of haplogroup G2 (P287).

G2a1 has an extremely low frequency in almost all populations except parts of the Caucasus Mountains.

In 2017, the SNP L293 was replaced by FGC7535, SK1106 and Z6552 as the defining SNPs of G2a1, due to the technical difficulty in testing for L23.

Almost all G2a1 persons have a value of 10 at short tandem repeat (STR) marker DYS392. The major G2a1 subgroup typically has higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons. Almost all G2a1a persons have a value of 15 or more at DYS385a, a finding which can be helpful in distinguishing G2a1a persons from non-G persons with similar marker values. In addition, the G2a1a persons tested were found to have a value of 9 at marker DYS505. This is several values below what is found in G subgroups, and is potentially the basis of additional subgrouping.

L293 which defines G2a1 is a SNP first identified at Family Tree DNA in 2011, and in 2012 was determined to encompass P16 positive persons. L293 is found at chromosome position 10595022 and represents a mutation from G to C. The forward primer is GTCCAGCTCATATGTCTTCAG, and the reverse primer is GACTTTCAACTTCTTACGGCTG. Under usual circumstances subgroup G2a1a persons would also have the distinctive mutation at SNP P16 that characterizes G2a1a. The reliability of P16 in identifying everyone who should be P16+ has been questioned. Because there are two strands involved, P16 results can be reported as P16.1 and P16.2, and persons may have varying results for components of the SNP. The P designation in P16 indicates it was identified at the University of Arizona, and P16's existence was first reported in 2000. These are the specifications listed for P16: located on the Y chromosome at 19434578; 19128376.....forward primer is aggctccatctgtagcacac.....reverse primer is taaccttatagaccaaccccg...the mutation is a change from A to T.

The only published study to date P16 (G2a1a) argues it is about 9,600 years old. This dating methodology is not universally accepted.


...
Wikipedia

...