| Haplogroup G1 | |
|---|---|
| Possible time of origin | perhaps 5,000 years BP |
| Possible place of origin | perhaps Iran |
| Ancestor | Haplogroup G (Y-DNA) |
| Descendants | G1a, G1b, G1c |
| Defining mutations | M285 (G1), P20 (G1a), L201, L202, L203 (G1a1), L830, L831, L832, L834, L835 (G1b) |
In human genetics, Haplogroup G1 (M285) is a Y-chromosome haplogroup. G1 is a branch of Haplogroup G Y-DNA (M201). Haplogroup G1 has an extremely low frequency in almost all countries except Iran and the countries adjoining Iran on the west.
Almost all G1 persons have the value of 12 at short tandem repeat (STR) marker DYS392 and all will have the M285 SNP mutation which characterizes this group. This value of 12 is also uncommon in other haplogroups. The M designation for M285 indicates it was first identified at Stanford University.
M285 has the following characteristics: The reference ID number is rs13447378.....Y position is 21151128....The forward primer sequence is ttatcctgagccgttgtccctg and the reverse sequence tgtagagacacggttgtaccct....The mutation is G to C. M285 was first reported in 2004 by Cinnioglu et al.
So far all persons tested who have the M285 mutation also are positive the M342 SNP mutation. If someone should test differently, his results would become the basis of a new G1 category. M342 is located at sequence position 21653330 and is AGAGAGTTTTCTAACAGGGCG in the forward primer and TGGGAATCACTTTTGCAACT in the reverse. It is a mutation from C to T. M342 was also identified at Stanford University,
In addition, within haplogroup G, those G1 persons tested so far are uniquely positive (derived) for SNP L89 while all other G persons are negative (ancestral). The L89 SNP mutation has also been found in other haplogroups. L89 is located at sequence position 8038725, and the reference ID number is rs35160044. It is a mutation from T to C. The L89 designation was provided by Family Tree DNA.
While research studies have not yet dated the origin of G1's M285 SNP mutation, it seemingly represents one of the older G groups, arising perhaps halfway between the origin of G and the present day based on the number of STR marker mutations.
The highest reported concentration of G1 and its subgroups in a single country is in Iran, with next most frequent concentrations in neighboring countries to the west. Specifically G1 was found in 5% of 177 samples from southern Iran in one study. The same study found G1 in 3% of 33 samples in northern Iran. The percentage in the south was almost equal to the percentage of G2, the only region in the world where G2 types were not found to be heavily dominant. Earlier studies which found about the same percentages of G in various parts of Iran failed to test specifically for G1.